Titanic1980 Titanic1980

04-01-2020
Mathematics

contestada

A line having a slope 3/4 passes through the point (-8,4). Write the equation of this line.

Respuesta :

Yang100 Yang100

04-01-2020

Answer:

y-4=3/4(x+8)

Step-by-step explanation:

y-y1=m(x-x1)

y-4=3/4(x-(-8))

y-4=3/4(x+8)

Answer Link

Otras preguntas

Which statement best describes Washington’s economy in the decades following World War II? A. Economic activity flattened and stagnated. B. Economic activity i

zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?

Explain how infection prevention policies and guidelines can be applied in own work setting.

PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2

help me asap !!!!!!!!

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The number of degrees of freedom for a test cross of an ss/rr individual would be

PLEASE HELP ME !!!!!!!!!! I BEG YOU !!!!!! PLEASE HAVE MERCY !!!! Use I = PRT to solve I = $350 P= $700 Find T (T

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac