deanbrosnahn64 deanbrosnahn64
  • 05-02-2020
  • Mathematics
contestada

X divided by 7/12=3 3/7

Respuesta :

corallshelton22 corallshelton22
  • 05-02-2020

Answer:X=2

Step-by-step explanation:

Answer Link

Otras preguntas

Which word correctly fills both blanks in the description below? Meiosis is an early step in sexual reproduction. In the process of meiosis, pairs of __________
How did supporters feel about his policy
An externality is said to exist when: individual actions are affected by external forces like the loss of U.S. jobs because of competition from abroad. individu
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
A loop of wire lies flat on a horizontal surface. A bar magnet is held above the center of a loop with south pole pointing down. Magnet is released. As magnet
What is the missing constant term in the perfect square that starts with x^2 + 1/2x
aa. Aa. AA. Zebra mussels have the following genotypes and phenotypes. Which cross would produce the greatest number of heterozygous. A) AA x aa. B) Aa x Aa
please help with this for 30 points
Before leaving the nucleus, the pre-mRNA transcript formed through transcription undergoes a series of enzyme-regulated modifications. Part of the process is il
A rectangular stained glass window is made up of identical triangular parts as pictured below. 36 inches 48 inches What is the area of the shaded triangular sec