6ixdreaa
6ixdreaa 6ixdreaa
  • 03-03-2020
  • History
contestada

i think number 9 is a but im not sure please help

i think number 9 is a but im not sure please help class=

Respuesta :

Lopezfamily10 Lopezfamily10
  • 03-03-2020

Answer:

its a

Explanation:

Answer Link

Otras preguntas

Triangle QRS has vertices Q(-2, 2), R(-3,-4), and S(1, -2). Write the coordinate notation for each translation given. Then write the coordinates of Q'R’ S' afte
Collection of a $1,000 Accounts Receivable A. decreases a liability $1,000; increases stockholders' equity $1,000. B. has no effect on total assets. C. increase
Water sources in the Alps are often used for to regulate the level of the North Sea. true or false
Approximately how many people attended the March on Washington?
The International Disc Jockey's Union has a wage contract that stipulates a yearly wage increase based on the Consumer Price Index. If this year's wage is $ 28.
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
What do we know about Elwood’s parents the nickel boys
What does 5-(-6) equal
What is the difference between simple diffusion and facilitated diffusion?
Convert the ratio 0.4 to 4 as a fraction in lowest terms