Ankney2026 Ankney2026

01-12-2020
Mathematics

contestada

-6 < -3; Divide both sides by -3

here is another question prove how smart you are

Respuesta :

colored0rain colored0rain

01-12-2020

Answer:

2 > 1

Step-by-step explanation:

-6 < -3 to -6/-3 > -3/-3 to 2 > 1

When dividing or multiplying by a negative, flip the inequality sign.

Answer Link

Otras preguntas

A cylinder has a radius of 8 centimeters and a height of 12 centimeters. A smaller cylinder has linear dimensions that are one-fourth the dimensions of the larg

What is the slope of the line through (2,−2)(2,-2) (2,−2) left parenthesis, 2, comma, minus, 2, right parenthesis and (9,3)(9,3) (9,3) left parenthesis, 9, c

An angle measures 136° less than the measure of its supplementary angle. What is the measure of each angle?

King and Civil Rights Read this excerpt from one of Martin Luther King's speeches. What method of protest is he advocating for in this speech? O writing letters

james when to sleep at 9:10 he woke up at 9:45 how long was he sleep

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

1. 5x + 2 = 27how to work backwards on this type of problem

how do i know when to add or subtract in an angle equation?

I was just wondering if someone would be able to thoroughly explain with formal fitness terminology how aerobic interval training (relating to sprints) will imp

bradly has 10 apples he gives 2 apples to tuimmy. how many apples does timmy have?