jburn88778286wy3s
jburn88778286wy3s jburn88778286wy3s
  • 01-02-2021
  • Mathematics
contestada

Find the area and perimeter of parallelogram.

Find the area and perimeter of parallelogram class=

Respuesta :

Аноним Аноним
  • 01-02-2021

Answer:

Area: 40 cm Perimeter: 30 cm

Step-by-step explanation:

When finding the area of a parallelogram, you use the inside length (in this case, 5cm) and the base (8cm). With perimeter, you use the base and the length (6cm).

8*5=40

8+8+6+6=30

Answer Link

Otras preguntas

Necesito identificación, entonces mamá da mi pasaporte a mi." me te le nos les
Laurent is preparing a fruit salad. She wants the total carbohydrates from pineapple and watermelon to equal 24 g. Pineapple has 3 g of carbohydrates per ounce
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
How is everyone? I know this isnt a math question but still how are ya?​
3. Why did most Texans favor joining the Confederate States of America? A. They supported the Republican idea of the abolition of slavery. B. Texans feared abol
pulling a 15 kg mass from a bucket from a depth of 6 meters well a man shook 20 sec what was his power
Helppp im not very good at math so can you guys help me​
4= –6 + v Help please
Which is required for a bacterial cell to replicate its DNA? a. tRNA b. DNA polymerase c. Rna stand with an origin of replication
What are las cofradias