indiaross6 indiaross6

04-02-2021
English

contestada

I need help! CP English question
Do you think that we need the fear of punishment to be virtuous?

Respuesta :

ProHelp ProHelp

04-02-2021

Answer:

No

Explanation:

Although some people might need the fear of punishment to develop a virtuous mindset, others will feel the longing to seek virtuous behaviors without being afraid of punishments.

Answer Link

Otras preguntas

3∙(a+x), if a=8; x=−10

Observing people and asking them questions are the two principal ways to obtain

A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the

William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Explain how infection prevention policies and guidelines can be applied in own work setting.

all other things being equal,the size of a population will decrease if

4 (2x-6)=10x-6. solve for x

What are the asymptotes of the hyperbola with equation 9y^2 - 4x^2 = 36?

this is a class called foundation seminar music and math