Holgoo8bS5eleniss Holgoo8bS5eleniss

02-01-2017
Geography

contestada

In the northern hemisphere, the coriolis effect causes winds to be deflected
a. to the right.
b. downwards.
c. upwards.
d. to the left.

Respuesta :

masterpotato13 masterpotato13

17-07-2018

I'd say to the right, North.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If you attended the us public high school the highest status crowds were probably the

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

Which two states were admitted to the united states as part of the missouri compromise?

A right triangle height of 10cm and a hypotenuse of 26cm what is the b

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.

Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels

Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses