liky liky
  • 01-02-2017
  • Mathematics
contestada

Find the value of a in the parallelogram

Find the value of a in the parallelogram class=

Respuesta :

bcalle
bcalle bcalle
  • 01-02-2017
Opposite sides of a parallelogram are congruent. a - 35 = 18.5
Add 35 to both sides
a = 35 + 18.5
a = 53.5
Answer Link

Otras preguntas

Spheres of influence were created in China as a way to protect trade for certain Western countries in specific parts of China. True False
example of public speech
QUESTION 25 How many H20 molecules are in 24 g H20?
How might this insect's appearance help keep it from getting eaten?
identify the function shown in the graph
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
Two reactions and their equilibrium constants are given. A + 2 B − ⇀ ↽ − 2 C K 1 = 2.79 2 C − ⇀ ↽ − D K 2 = 0.186 Calculate the value of the equilibrium consta
Blair Scott started a sole proprietorship by depositing $75,000 cash in a business checking account. During the accounting period, the business borrowed $30,000
why is the nucleus considered the command center of the cell?​
What is the constant of proportionality between y and x in the graph?