smiles0809 smiles0809

03-02-2017
Mathematics

contestada

A girl is 21 years old and her brother is a third her age. When the girl is 36, what will be the age of her brother?

Respuesta :

Аноним Аноним

12-02-2017

if the girl is 21 years old and her brother is a third of her age means he is 7 years old. now his sister is 36 yard old so that means he is 12 years old

Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa

Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October

a antonym for biosphere

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress

What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims