madi3sabamshonsteve madi3sabamshonsteve
  • 04-02-2017
  • Mathematics
contestada

6/6 as a mixed number

Respuesta :

haileyeiermanm
haileyeiermanm haileyeiermanm
  • 04-02-2017
it 1 i hope its right 

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What role did John Marshall serve in the new government? A. Head of Congress B. President C. Chief Justice D. Vice president Answer is C.
accounting i know that when there's two panels its debit and credit but what is the third for what is each one
Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels
find the greatest common divisor of 9 and 27
the value x+x(x×) when x = 2
Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?
(50)points 5 questions!
In what country did the zimmerman telegram originate? a. germany c. russia b. france d. italy
What two molecules are produced by the light reactions and used to power the calvin cycle?