desimmeter desimmeter
  • 02-04-2017
  • History
contestada

Why was traveling in ancient greece difficult?

Respuesta :

smellykat
smellykat smellykat
  • 02-04-2017
The terrain, mountains and hills, makes it difficult to travel in Greece.
Answer Link

Otras preguntas

A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
when Jefferson took office he did what
Do all your pet's offspring look the same? If no, then explain why they look different.
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5