dovescry76 dovescry76
  • 03-04-2017
  • Mathematics
contestada

Huilan is 6 years older than Thomas. The sum of their ages is 80 . What is Thomas's age?

Respuesta :

annafattie annafattie
  • 03-04-2017
80-6= 74. 74/2=37 thomas age is 37
Answer Link

Otras preguntas

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
what rule does static electricity follow
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
the reproductive system of a male mammal provides
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
define concentric circles
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
What are the factors of 6x + 24?